Kuvat / Äänet

Mitä

Lehtipistiäiset Heimo Tenthredinidae

Havainnoija

treichard

Päivämäärä

Lokakuu 30, 2020 03:00 PM EDT

Kuvat / Äänet

Havainnoija

keimwj

Päivämäärä

Kesäkuu 7, 2014 05:04 PM EDT

Kuvaus

07 Jun 2014.
Bowman's Hill Wildflower Preserve, Bucks Co, PA.
Larva.
Found on Verbesina alternifolia.

Kuvat / Äänet

Havainnoija

sskorpio

Päivämäärä

Toukokuu 27, 2019 10:28 AM MSK

Kuvaus

Larva on spruce

Kuvat / Äänet

Square

Havainnoija

danabrennan

Päivämäärä

Toukokuu 28, 2020 12:47 PM AKDT

Kuvaus

Host is Alaskan paper birch. Lifescanner ID Eriocraniidae from BOLD-F37. DNA barcode: COI-5P
AACCTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCAGAATTAGGTAACCCTGGTTCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGGGCCCCAGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCTCCATCATTAACTTTATTAATTTCTAGAAGATTTGTAGAAAACGGAGCAGGAACTGGGTGAACAGTATACCCTCCTTTATCTTCTAATATTGCCCATGCGGGCAGTTCTGTTGACTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGGGCTGTTAATTTTATTACAACAGTAATTAATATGCGACCCTATGGAATAAGATTAGATCGAATGCCATTATTTGTTTGAGCTGTAGCCATTACTGCTTTATTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATCACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTCG-

Kuvat / Äänet

Square

Havainnoija

alainhogue

Päivämäärä

Heinäkuu 30, 2020 08:41 PM EDT

Kuvaus

Ulmus

Kuvat / Äänet

Mitä

Lehtipistiäiset Heimo Tenthredinidae

Havainnoija

trailblazr

Päivämäärä

Maaliskuu 7, 2020 12:15 PM HST

Kuvat / Äänet

Mitä

Suku Dolerus

Havainnoija

woodmen19

Päivämäärä

Kesäkuu 13, 2017 04:03 AM MSK

Kuvat / Äänet

Mitä

Lehtipistiäiset Heimo Tenthredinidae

Havainnoija

cyanide-bofu

Päivämäärä

Tammikuu 22, 2020 05:19 PM CST

Kuvat / Äänet

Square

Mitä

Suku Sirex

Havainnoija

debbie-seabrook

Päivämäärä

Marraskuu 24, 2019 02:16 PM EST

Kuvat / Äänet

Havainnoija

richardlbaxter

Päivämäärä

Kesäkuu 3, 2017 11:02 AM EDT

Kuvaus

Freshly hatched larvae feeding on what looks like cottonwood, not sure if these are hymenopterans or lepidopterans

Kuvat / Äänet

Havainnoija

treichard

Päivämäärä

Heinäkuu 2, 2019 11:55 PM EDT

Kuvat / Äänet

Square

Mitä

Hohtonuijapistiäiset Suku Abia

Havainnoija

richardmonteverdense

Päivämäärä

Heinäkuu 24, 2019 02:56 PM EDT

Kuvat / Äänet

Havainnoija

jasonheadley

Päivämäärä

Kesäkuu 17, 2019 03:41 PM PDT

Kuvat / Äänet

Havainnoija

melissaeldridge

Päivämäärä

Syyskuu 3, 2019 03:30 PM EDT

Kuvaus

Insect pupa found in firewood log in Shenandoah National Park. The firewood was bought in the park. Between 1” and 1.5” in length. Long antennae, legs, and abdomen. Suspected to be Pigeon Tremex Horntail pupa.

Kuvat / Äänet

Square

Havainnoija

nearctic

Päivämäärä

Syyskuu 1, 2019 11:32 AM EDT

Kuvaus

Dead. Ovipositor lodged in a birch.

Kuvat / Äänet

Mitä

Suku Dolerus

Havainnoija

humanbyweight

Päivämäärä

Huhtikuu 10, 2009 11:07 AM EDT

Kuvat / Äänet

Havainnoija

tessthenaturalist

Päivämäärä

Huhtikuu 12, 2018 06:07 PM EDT

Kuvaus

Feeding on swamp chestnut oak. Parasatoid wasps regularly laying eggs in some individuals of this species.

Kuvat / Äänet

Havainnoija

nakarb

Päivämäärä

Toukokuu 8, 2015 11:28 AM MSK