Kuvat / Äänet

Mitä

Kantasienet (Pääjakso Basidiomycota)

Havainnoija

krizztofu

Päivämäärä

Elokuu 5, 2022 01:31 PM PDT

Kuvaus

Growing on Madrone , appears to have pores. I took a small tissue sample for sequencing .

Kuvat / Äänet

Havainnoija

dnl_biodisperso

Päivämäärä

Joulukuu 27, 2021 02:16 AM -03

Kuvat / Äänet

Havainnoija

giacomo_bruni

Päivämäärä

Joulukuu 2, 2014 05:08 PM -03

Kuvat / Äänet

Havainnoija

pulk

Päivämäärä

Marraskuu 30, 2021

Kuvaus



At the base of a Douglas-fir. Western redcedar also present.

Mild smell, mild taste.

Additional notes for sequences (bases on the right):

ITS: Sequenced by the Matheny Lab

Originally posted to Mushroom Observer on Jan. 17, 2022.

Tunnisteet

Kuvat / Äänet

Havainnoija

capt1matt

Päivämäärä

Heinäkuu 7, 2022 09:54 AM PDT

Kuvat / Äänet

Havainnoija

warren_cardimona

Päivämäärä

Kesäkuu 12, 2022 04:28 PM PDT

Kuvaus

Stigmatella aurantiaca(?)

Kuvat / Äänet

Mitä

Luteet (Alalahko Heteroptera)

Havainnoija

cynestor

Päivämäärä

Kesäkuu 28, 2022 02:12 PM PDT

Kuvat / Äänet

Havainnoija

rahunt2

Päivämäärä

Toukokuu 15, 2009

Paikka

Costa Rica (Google, OSM)

Kuvat / Äänet

Havainnoija

uwkwaj

Päivämäärä

Toukokuu 6, 2019

Kuvat / Äänet

Havainnoija

brian_r_mayes

Päivämäärä

Toukokuu 1, 2022 08:02 AM AEST

Kuvat / Äänet

Havainnoija

disciseda

Päivämäärä

Elokuu 25, 2010 11:48 AM MDT

Kuvat / Äänet

Havainnoija

kevinhintsa

Päivämäärä

Toukokuu 2022

Paikka

Yksityinen

Kuvaus

Contra Costa County , California . Known site , exact location not shown .

Kuvat / Äänet

Havainnoija

luca_hickey

Päivämäärä

Joulukuu 17, 2019

Kuvaus

Interesting

Kuvat / Äänet

Havainnoija

jlippert2218

Päivämäärä

Marraskuu 1, 2020 03:00 PM PST

Kuvaus

On cantharellus cascadensis. Located by Melissa Johnson-Ravare. T21S R5E Sec 36 NW4 3500 ft elevation

Kuvat / Äänet

Havainnoija

yanivsegal

Päivämäärä

Maaliskuu 2022

Paikka

Israel (Google, OSM)

Kuvaus

Calongea prieguensis

Kuvat / Äänet

Havainnoija

luca_hickey

Päivämäärä

Syyskuu 27, 2020 10:10 AM PDT

Kuvat / Äänet

Havainnoija

jgarciapelayohsu

Päivämäärä

Joulukuu 9, 2021 09:55 AM PST

Kuvat / Äänet

Havainnoija

betweenthelyons

Päivämäärä

Maaliskuu 2022

Kuvaus

Lots in burn zone

Kuvat / Äänet

Päivämäärä

Maaliskuu 2022

Paikka

Florida, US (Google, OSM)

Kuvaus

Additional photos and close ups of main individual.

Kuvat / Äänet

Havainnoija

corndog

Päivämäärä

Maaliskuu 22, 2022 08:18 PM PDT

Kuvat / Äänet

Havainnoija

morganstickrod

Päivämäärä

Maaliskuu 2022

Kuvat / Äänet

Mitä

Rivikäävät (Suku Antrodia)

Havainnoija

riverahlquist

Päivämäärä

Maaliskuu 17, 2022 01:38 PM CDT

Kuvat / Äänet

Havainnoija

lilcar

Päivämäärä

Kesäkuu 5, 2021 04:53 PM CEST

Kuvat / Äänet

Havainnoija

logancrees

Päivämäärä

Maaliskuu 10, 2022 11:09 AM CST

Kuvat / Äänet

Havainnoija

malacothrix

Päivämäärä

Tammikuu 15, 2022 11:54 AM PST

Kuvaus

SOMA foray

Found amongst Umbellularia californica and Psuedotsuga menziesii with scattered Quercus agrifolia nearby

Kuvat / Äänet

Havainnoija

jennykeeping

Päivämäärä

Joulukuu 20, 2018 05:55 AM SAST

Kuvat / Äänet

Havainnoija

ym_wang_pnw

Päivämäärä

Helmikuu 1, 2022 11:13 AM UTC

Kuvat / Äänet

Mitä

Myyränlakit (Suku Rhodocybe)

Havainnoija

ym_wang_pnw

Päivämäärä

Helmikuu 18, 2022 03:38 PM PST

Kuvat / Äänet

Havainnoija

lizziepop

Päivämäärä

Tammikuu 30, 2009

Kuvaus

Bulbous Mushroom


Ball shaped cap when young and purple-pinkish colour. Becoming flat and caramel brown, Bulbous clavate stem, creamy lamellae,cap diameter 4-5,5cm, height 5cm, bulb diameter 3-4,5cm, growing under Tipiana

Tunnisteet

Kuvat / Äänet

Havainnoija

stucumber_

Päivämäärä

Helmikuu 10, 2019 02:48 PM PST

Kuvat / Äänet

Havainnoija

biocowboy

Päivämäärä

Maaliskuu 4, 2022 01:47 PM PST

Kuvat / Äänet

Mitä

Sinirintakalastaja (Halcyon malimbica)

Havainnoija

nikborrow

Päivämäärä

Tammikuu 31, 2022

Kuvat / Äänet

Havainnoija

dannymi

Päivämäärä

Marraskuu 5, 2018

Kuvat / Äänet

Havainnoija

claudia_jeannette

Päivämäärä

Lokakuu 2011

Kuvat / Äänet

Havainnoija

garmonb0zia

Päivämäärä

Maaliskuu 21, 2019 12:27 PM PDT

Kuvaus

Growing on ericameria stem, strongly farinaceous odor.

Kuvat / Äänet

Havainnoija

chloe_and_trevor

Päivämäärä

Tammikuu 8, 2022 06:16 PM PST

Kuvat / Äänet

Havainnoija

melsocal

Päivämäärä

Helmikuu 21, 2022 10:42 AM PST

Kuvat / Äänet

Havainnoija

fungee

Päivämäärä

Heinäkuu 2019

Paikka

New York, US (Google, OSM)

Kuvaus

red oak, hemlock, yellow birch

Tunnisteet

c7

Kuvat / Äänet

Havainnoija

andesgascon_alex

Päivämäärä

Huhtikuu 6, 2020

Kuvat / Äänet

Havainnoija

morganstickrod

Päivämäärä

Marraskuu 2020

Kuvat / Äänet

Havainnoija

danielle775

Päivämäärä

Elokuu 25, 2021 08:06 AM UTC

Kuvaus

Growing on decomposing White Birch

Kuvat / Äänet

Havainnoija

chelseamcd

Päivämäärä

Toukokuu 19, 2020

Paikka

Castlegar (Google, OSM)

Kuvat / Äänet

Mitä

Vuotavinokas (Tectella patellaris)

Havainnoija

autumna

Päivämäärä

Marraskuu 15, 2020 01:48 PM PST

Kuvaus

I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.

Sequenced on 3/3/21 by FunDis:

Nucleotide Sequence

CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT

Kuvat / Äänet

Havainnoija

chuckie1997

Päivämäärä

Lokakuu 24, 2020 07:13 PM PDT

Paikka

Beaverton (Google, OSM)

Kuvat / Äänet

Havainnoija

brettjackson

Päivämäärä

Helmikuu 17, 2022 02:09 PM CST

Kuvaus

On the underside of Quercus pagoda leaf. A few alate individuals present.

White coloring nearby is probably the mycelial mat formed by Erysiphe abbreviata, often found hypophyllous on Q. pagoda .

Kuvat / Äänet

Mitä

Tähtirotkokielo (Maianthemum stellatum)

Havainnoija

leptonia

Päivämäärä

Toukokuu 29, 2020 09:15 AM PDT

Tunnisteet

Kuvat / Äänet

Havainnoija

tmurray74

Päivämäärä

Maaliskuu 2014

Kuvaus

Echinodontium ballouii wasn't seen for 100 years until Larry Millman found it in an Atlantic White Cedar swamp. Larry took me to the site, (which I can't say where it is) and we found about a dozen of these again 4 years after the first visit.

Kuvat / Äänet

Havainnoija

dwborland

Päivämäärä

Heinäkuu 28, 2013 06:12 PM EDT

Kuvaus

Leucopaxillus gracillimus.0182.7.28.13.dwb/alachua co. florida

rather uncommon

syn. Clitocybe rappiana

Kuvat / Äänet

Havainnoija

silversea_starsong

Päivämäärä

Maaliskuu 5, 2017 09:21 AM PST

Kuvat / Äänet

Havainnoija

kschnei

Päivämäärä

Huhtikuu 18, 2019 11:44 AM PDT

Kuvaus

Tiny 1-mm springtail swept from grasses and collected temporarily for photomicrographs.

Kuvat / Äänet

Havainnoija

rtshaw80

Päivämäärä

Maaliskuu 27, 2015 10:56 AM CDT

Kuvat / Äänet

Havainnoija

rtshaw80

Päivämäärä

Maaliskuu 24, 2015 12:33 PM CDT

Kuvat / Äänet

Mitä

Isoaaltoselkä (Saccopteryx bilineata)

Havainnoija

rtshaw80

Päivämäärä

Maaliskuu 24, 2015 08:06 AM CDT

Kuvat / Äänet

Havainnoija

dgreenberger

Päivämäärä

Helmikuu 6, 2022 04:51 PM PST

Kuvat / Äänet

Havainnoija

panarthropodism

Päivämäärä

Huhtikuu 18, 2021 02:24 PM EDT

Kuvat / Äänet

Mitä

Tähtisilonen (Diderma asteroides)

Havainnoija

alison_pollack

Päivämäärä

Helmikuu 4, 2022 03:35 PM HST

Kuvaus

I was thrilled when @graysquirrel found these as we were poking around the woods together! Such a beautiful species!

Kuvat / Äänet

Havainnoija

kdff

Päivämäärä

Tammikuu 28, 2022

Kuvaus

On Toyon berries, Heteromeles arbutifolia.

Kuvat / Äänet

Havainnoija

mycotrope

Päivämäärä

Toukokuu 30, 2015 02:28 PM PDT

Tunnisteet

Kuvat / Äänet

Havainnoija

kestrel

Päivämäärä

Tammikuu 30, 2022 03:31 PM PST

Kuvat / Äänet

Havainnoija

colinpurrington

Päivämäärä

Heinäkuu 25, 2017 04:01 PM EDT

Kuvaus

On Dacrymyces (I think).

Kuvat / Äänet

Mitä

Siniläätteet (Suku Saussurea)

Havainnoija

wangchuk

Päivämäärä

Elokuu 22, 2021 09:35 AM +06

Kuvaus

Alpine screes

Kuvat / Äänet

Mitä

Sammalnapalakit (Suku Arrhenia)

Havainnoija

malacothrix

Päivämäärä

Joulukuu 10, 2021 12:41 PM PST

Kuvat / Äänet

Mitä

Karikat (Suku Pseudobaeospora)

Havainnoija

betweenthelyons

Päivämäärä

Tammikuu 21, 2022 03:52 PM UTC

Kuvat / Äänet

Havainnoija

spencer_wimmer

Päivämäärä

Heinäkuu 25, 2021 01:42 PM MDT

Kuvat / Äänet

Havainnoija

faerthen

Päivämäärä

Toukokuu 19, 2018 12:13 PM PDT

Kuvaus

Turned him up cleaning the glass. This is the biggest sculpin I've ever seen in the creek, though the camera lens wants to make my fingers look bigger than they are relative to the fish.

Kuvat / Äänet

Havainnoija

crabsandshrimps

Päivämäärä

Heinäkuu 13, 2010 08:05 AM PDT

Kuvat / Äänet

Havainnoija

alex_bairstow

Päivämäärä

Tammikuu 20, 2019 05:01 PM PST

Kuvat / Äänet

Mitä

Suku Sidusa

Havainnoija

chloe_and_trevor

Päivämäärä

Joulukuu 26, 2021 12:59 PM PST

Kuvat / Äänet

Havainnoija

damontighe

Päivämäärä

Toukokuu 27, 2019 09:57 AM PDT

Kuvat / Äänet

Havainnoija

kueda

Päivämäärä

Helmikuu 12, 2021 10:32 AM PST

Kuvaus

Found several under rocks and logs on a rocky, grassy hillside, maybe 1-2 mm long, fairly active. I think these should be called candy cane mites or Christmas mites.

Tunnisteet

Kuvat / Äänet

Havainnoija

thomaseverest

Päivämäärä

Joulukuu 29, 2017

Kuvaus

In beached driftwood, third photo is young found brooding in the gills of larger individuals

Kuvat / Äänet

Havainnoija

flygrl67

Päivämäärä

Tammikuu 2022

Kuvaus

Chartreuse colored cap, bulb, and mycelial threads; reddish brown discolorations on cap; olivaceus-black KOH rxn on cap

Kuvat / Äänet

Havainnoija

flygrl67

Päivämäärä

Tammikuu 2022

Tunnisteet

Kuvat / Äänet

Havainnoija

imlichentoday

Päivämäärä

Syyskuu 16, 2021 10:00 AM PDT

Kuvaus

Garden Spot East Anacapa ~25ft

Kuvat / Äänet

Havainnoija

mzuckerfish

Päivämäärä

Lokakuu 2021

Kuvat / Äänet

Havainnoija

uwkwaj

Päivämäärä

Marraskuu 27, 2021 10:35 AM PST

Kuvat / Äänet

Havainnoija

maricel-patino

Päivämäärä

Joulukuu 11, 2021 02:25 AM EST

Kuvaus

On abandoned fire wood. Hidden against ground and adding and growing on debris. 4 pores per mm.
Bruising pinkish. Spores: 3.7-4 x 4.9-5.4 with drop. Basidia: up to 37 x 7.4 um with four sterigmata. Lots of cystidia with round and pointy ends. Pine Barrens.

Kuvat / Äänet

Havainnoija

dr_q

Päivämäärä

Kesäkuu 27, 2019 02:59 PM PDT

Kuvaus

Not an insect! Springtails are a different Class. This particular springtail is a golden snowflea.

Kuvat / Äänet

Havainnoija

dlbowls

Päivämäärä

Tammikuu 2017

Kuvaus

The orange ones. Our ID is based on comparison to pictures on Bugguide.net. We are hoping for confirmation from them.

Kuvat / Äänet

Havainnoija

glmory

Päivämäärä

Helmikuu 16, 2017 06:50 PM PST

Kuvat / Äänet

Havainnoija

cedric_lee

Päivämäärä

Maaliskuu 4, 2017 11:09 AM PST

Kuvat / Äänet

Havainnoija

divindk

Päivämäärä

Huhtikuu 25, 2021 10:04 AM PDT

Kuvaus

Podocerus cristatus amphipod at Santa Cruz Island, CA. Depth 60' / 20M. Water temp 50 degrees F

Kuvat / Äänet

Havainnoija

sea-kangaroo

Päivämäärä

Lokakuu 19, 2018 09:20 AM PDT

Kuvaus

Dive site Emerald Cove, max depth 61ft/19m.

Decently large (~4" diameter) solitary anemone.

Kuvat / Äänet

Havainnoija

uwkwaj

Päivämäärä

Marraskuu 13, 2021

Kuvaus

With egg masses

Tunnisteet

Kuvat / Äänet

Havainnoija

socal_angling

Päivämäärä

Tammikuu 9, 2022 10:48 AM UTC

Kuvaus

Parasitic isopod on the tail of a white surfperch

Kuvat / Äänet

Havainnoija

jonaleef

Päivämäärä

Elokuu 2021

Tunnisteet

Kuvat / Äänet

Havainnoija

dgreenberger

Päivämäärä

Tammikuu 2021

Kuvat / Äänet

Havainnoija

mcduck

Päivämäärä

Syyskuu 15, 2015

Kuvaus

27mm length. Second photo is close-up of rhinophore. Specimen at CASIZ 208937.

Kuvat / Äänet

Havainnoija

anudibranchmom

Päivämäärä

Kesäkuu 2016

Kuvat / Äänet

Havainnoija

leslieh

Päivämäärä

Marraskuu 14, 2021

Kuvaus

inverts from RV Yellowfin cruise_Dr. Kimo Morris' marine biology class

Kuvat / Äänet

Havainnoija

zabbey

Päivämäärä

Maaliskuu 7, 2019 10:45 AM PST

Kuvaus

Verrucaria?

Kuvat / Äänet

Mitä

Verikorpijäkälä (Mycoblastus sanguinarius)

Havainnoija

gnomewardbound

Päivämäärä

Maaliskuu 13, 2021 03:16 PM PST

Kuvat / Äänet

Havainnoija

silversea_starsong

Päivämäärä

Huhtikuu 2018

Kuvat / Äänet

Mitä

Rihmanaava (Usnea longissima)

Havainnoija

kkellman

Päivämäärä

Joulukuu 2019

Kuvat / Äänet

Mitä

Punapaanujäkälä (Psora decipiens)

Havainnoija

susanmf

Päivämäärä

Maaliskuu 22, 2021 10:56 AM PDT

Kuvat / Äänet

Havainnoija

acastelein

Päivämäärä

Tammikuu 5, 2022 06:24 PM PST

Kuvat / Äänet

Havainnoija

acastelein

Päivämäärä

Tammikuu 5, 2022 06:33 PM PST

Kuvat / Äänet

Havainnoija

naturecandids

Päivämäärä

Tammikuu 2, 2022 12:51 PM PST

Kuvaus

There were hundreds of these fellows in a small, seasonal pond (last photo).

Kuvat / Äänet

Havainnoija

squamatologist

Päivämäärä

Kesäkuu 5, 2008 12:09 PM CDT

Kuvaus

Little Monardella (Monardella nana), eastern San Diego County, California

Kuvat / Äänet

Havainnoija

robertdavis

Päivämäärä

Syyskuu 25, 2019 08:42 AM PDT

Kuvaus

Host mushroom chanterelle, found in the coast range of Oregon. Research and suggestions led to entoloma parasiticum as the most likely candidate.